Cyclin-Dependent Kinase inhibitor 2A (CDKN2A) - coding DNA reference sequence

(used for mutation description)

(last modified March 9, 2007)

Coding DNA reference sequence of CDKN2A (p16), based on NM_000077.3. Please note that the CDKN2A gene encodes several alternative transcripts. One alternative transcripts extends the exon 2 sequence into intron 1 (NM_058197.3). Another major transcript uses another promoter (NM_058195.2), upstream of that of the p16-transcript shown below. This transcript encodes another protein, p14ARF (see upstream sequence). Amino acid numbering for the p14ARF protein sequence is shown in red bold italic.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .         
                             ctcctccgagcactcgctcacggcgtcccctt       -181

 .         .         .         .         .         .         
 gcctggaaagataccgcggtccctccagaggatttgagggacagggtcggagggggctct       -121

 .         .         .         .         .         .         
 tccgccagcaccggaggaagaaagaggaggggctggctggtcaccagagggtggggcgga       -61

 .         .         .         .         .         .         
 ccgcgtgcgctcggcggctgcggagagggggagagcaggcagcgggcggcggggagcagc       -1

          .         .         .         .         .         .
 ATGGAGCCGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCG        60
 M  E  P  A  A  G  S  S  M  E  P  S  A  D  W  L  A  T  A  A          20

          .         .         .         .         .         .
 GCCCGGGGTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGGCGCTGCCCAACGCA        120
 A  R  G  R  V  E  E  V  R  A  L  L  E  A  G  A  L  P  N  A          40

          .         .         . | 2        .         .         .
 CCGAATAGTTACGGTCGGAGGCCGATCCAG | GTCATGATGATGGGCAGCGCCCGAGTGGCG     180
 P  N  S  Y  G  R  R  P  I  Q   | V  M  M  M  G  S  A  R  V  A       60
                                    H  D  D  G  Q  R  P  S  G  G     75 (p14)
          .         .         .         .         .         .
 GAGCTGCTGCTGCTCCACGGCGCGGAGCCCAACTGCGCCGACCCCGCCACTCTCACCCGA        240
 E  L  L  L  L  H  G  A  E  P  N  C  A  D  P  A  T  L  T  R          80
   A  A  A  A  P  R  R  G  A  Q  L  R  R  P  R  H  S  H  P  T       95 (p14)

          .         .         .         .         .         .
 CCCGTGCACGACGCTGCCCGGGAGGGCTTCCTGGACACGCTGGTGGTGCTGCACCGGGCC        300
 P  V  H  D  A  A  R  E  G  F  L  D  T  L  V  V  L  H  R  A          100
   R  A  R  R  C  P  G  G  L  P  G  H  A  G  G  A  A  P  G  R       115 (p14)

          .         .         .         .         .         .
 GGGGCGCGGCTGGACGTGCGCGATGCCTGGGGCCGTCTGCCCGTGGACCTGGCTGAGGAG        360
 G  A  R  L  D  V  R  D  A  W  G  R  L  P  V  D  L  A  E  E          120
   G  A  A  G  R  A  R  C  L  G  P  S  A  R  G  P  G  X              133 (p14)

          .         .         .         .         .         .
 CTGGGCCATCGCGATGTCGCACGGTACCTGCGCGCGGCTGCGGGGGGCACCAGAGGCAGT        420
 L  G  H  R  D  V  A  R  Y  L  R  A  A  A  G  G  T  R  G  S          140

          .         .         .        | 3 .         . 
 AACCATGCCCGCATAGATGCCGCGGAAGGTCCCTCAG | ACATCCCCGATTGA              471
 N  H  A  R  I  D  A  A  E  G  P  S  D |   I  P  D  X                156

          .         .         .         .         .         .
 aagaaccagagaggctctgagaaacctcgggaaacttagatcatcagtcaccgaaggtcc        *60

          .         .         .         .         .         .
 tacagggccacaactgcccccgccacaacccaccccgctttcgtagttttcatttagaaa        *120

          .         .         .         .         .         .
 atagagcttttaaaaatgtcctgccttttaacgtagatatatgccttcccccactaccgt        *180

          .         .         .         .         .         .
 aaatgtccatttatatcattttttatatattcttataaaaatgtaaaaaagaaaaacacc        *240

          .         .         .         .         .         .
 gcttctgccttttcactgtgttggagttttctggagtgagcactcacgccctaagcgcac        *300

          .         .         .         .         .         .
 attcatgtgggcatttcttgcgagcctcgcagcctccggaagctgtcgacttcatgacaa        *360

          .         .         .         .         .         .
 gcattttgtgaactagggaagctcaggggggttactggcttctcttgagtcacactgcta        *420

          .         .         .         .         .       
 gcaaatggcagaaccaaagctcaaataaaaataaaataattttcattcattcactca           *477

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Cyclin-Dependent Kinase inhibitor 2A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.